pRKVSV Rac
(Plasmid
#50535)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 50535 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepRKVSV
-
Backbone manufacturerPMID 14729061
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesmall GTPase
-
Alt nameRac I
-
Alt nameRAC1
-
SpeciesH. sapiens (human)
-
Entrez GeneRAC1 (a.k.a. MIG5, MRD48, Rac-1, TC-25, p21-Rac1)
- Promoter CMV
-
Tag
/ Fusion Protein
- 2X VSV (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer pRK KZ FW (TAGAATAACATCCACTTTGCC)
- 3′ sequencing primer GFP ASO (TTGTAACCATTATAAGCTGC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRKVSV Rac was a gift from Kenneth Yamada (Addgene plasmid # 50535 ; http://n2t.net/addgene:50535 ; RRID:Addgene_50535) -
For your References section:
Glycogen synthase kinase-3 regulates cytoskeleton and translocation of Rac1 in long cellular extensions of human keratinocytes. Koivisto L, Hakkinen L, Matsumoto K, McCulloch CA, Yamada KM, Larjava H. Exp Cell Res. 2004 Feb 1;293(1):68-80. 10.1016/j.yexcr.2003.09.026 PubMed 14729058