pRKVSV FAT
(Plasmid #50533)

• Depositing Lab: Kenneth Yamada
• Publication: Segarra et al FASEB J. 2005 Nov;19(13):1875-7.

Backbone

• Vector backbone: pRKVSV
• Backbone manufacturer: PMID 14729059
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: protein tyrosine kinase, domain
• Alt name: FAK
• Alt name: PTK2
• Species: M. musculus (mouse)
• Mutation: truncated (NT2630-3268)
• Promoter: CMV
• Tag / Fusion Protein:
  • 2X VSV (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: pRK KZ FW (TAGAATAACATCCACTTTGCC)
• 3′ sequencing primer: GFP ASO (TTGTAACCATTATAAGCTGC)

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry