pRK GFP Vinculin
(Plasmid
#50531)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50531 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGZ21dxZ
-
Backbone manufacturerYamada Lab, Tamura et al., Science 280: 1614-7 (1998)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVinculin
-
Alt nameVCL
-
Alt namefocal adhesion protein
-
SpeciesG. gallus (chicken)
-
Entrez GeneVCL (a.k.a. VINC1)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (not destroyed)
- 3′ cloning site unknown (not destroyed)
- 5′ sequencing primer GFP FW (AAAGACCCCAACGAGAAGCG)
- 3′ sequencing primer GFP ASO (TTGTAACCATTATAAGCTGC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRK GFP Vinculin was a gift from Kenneth Yamada (Addgene plasmid # 50531 ; http://n2t.net/addgene:50531 ; RRID:Addgene_50531)