pmCherry Vinculin
(Plasmid #50527)

• Depositing Lab: Kenneth Yamada
• Publication: Yamada Lab Plasmids (unpublished)

Backbone

• Vector backbone: pmCherry NBC1
• Backbone manufacturer: Yamada Lab
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Vinculin
• Alt name: VCL
• Alt name: focal adhesion protein
• Species: G. gallus (chicken)
• Entrez Gene: VCL (a.k.a. VINC1)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: mCherry FW (CACAACGAGGACTACACCATC)
• 3′ sequencing primer: EGFP RVs (CTCTACAAATGTGGTATGGCTG)

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Replacement of Clontech pEGFP C1 vector EGFP with mCherry and MCS modification with Bam HI mutation of original Bam H I.