pIL2R FAK
(Plasmid
#50524)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 50524 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCMVIL2R(pIL2R)
-
Backbone manufacturerBruce Howard Lab, PubMed ID 1373145
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameprotein tyrosine kinase, domain
-
Alt nameFAK
-
Alt namePTK2
-
SpeciesM. musculus (mouse)
- Promoter CMV
-
Tag
/ Fusion Protein
- IL-2R (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (not destroyed)
- 3′ cloning site unknown (not destroyed)
- 5′ sequencing primer IL2R FW (TCCTGCCTCGTCACAACAAC)
- 3′ sequencing primer Il2R AS2 (CCTTAGAGCTTTAAATCTCTG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Vector contains truncated IL-2R alpha subunit without cytoplasmic domain (Tac antigen) for membrane localization and clustering
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIL2R FAK was a gift from Kenneth Yamada (Addgene plasmid # 50524 ; http://n2t.net/addgene:50524 ; RRID:Addgene_50524) -
For your References section:
Regulation of fibronectin receptor distribution. LaFlamme SE, Akiyama SK, Yamada KM. J Cell Biol. 1992 Apr;117(2):437-47. 10.1083/jcb.117.2.437 PubMed 1373145