pGFP-PTEN C124A
(Plasmid
#50520)
-
PurposeThis plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50520 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGZ21dxZ
-
Backbone manufacturerYamada Lab, Tamura et al., Science 280: 1614-7 (1998)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePTEN
-
Alt nameMMAC1
-
Alt nametumor suppressor, phosphatase, mutated
-
SpeciesH. sapiens (human)
-
MutationC124A
-
Entrez GenePTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, TEP1)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GFP FW (AAAGACCCCAACGAGAAGCG)
- 3′ sequencing primer GFP ASO (TTGTAACCATTATAAGCTGC) (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGFP-PTEN C124A was a gift from Kenneth Yamada (Addgene plasmid # 50520 ; http://n2t.net/addgene:50520 ; RRID:Addgene_50520) -
For your References section:
Inhibition of cell migration, spreading, and focal adhesions by tumor suppressor PTEN. Tamura M, Gu J, Matsumoto K, Aota S, Parsons R, Yamada KM. Science. 1998 Jun 5;280(5369):1614-7. 10.1126/science.280.5369.1614 PubMed 9616126