pGFP-PTEN
(Plasmid #50519)

• Purpose: This plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.
• Depositing Lab: Kenneth Yamada
• Publication: Tamura et al Science. 1998 Jun 5;280(5369):1614-7.

Backbone

• Vector backbone: pGZ21dxZ
• Backbone manufacturer: Yamada Lab, Tamura et al., Science 280: 1614-7 (1998)
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: PTEN
• Alt name: MMAC1
• Alt name: tumor suppressor, phosphatase
• Species: H. sapiens (human)
• Entrez Gene: PTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, TEP1)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: GFP FW (AAAGACCCCAACGAGAAGCG)
• 3′ sequencing primer: GFP ASO (TTGTAACCATTATAAGCTGC)

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry