Skip to main content
Addgene

pECE beta1 R760A
(Plasmid #50511)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50511 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pECE
  • Backbone manufacturer
    Bill Rutter
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    integrin beta1
  • Alt name
    ITGB1
  • Alt name
    transmembrane glycoprotein
  • Species
    H. sapiens (human)
  • Mutation
    R760A
  • Entrez Gene
    ITGB1 (a.k.a. CD29, FNRB, GPIIA, MDF2, MSK12, VLA-BETA, VLAB)
  • Promoter SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pECE FW (CAAGTTAACAACAACAATTGC)
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The original beta1 WT clone obtained from Dr. Ruoslahti had 5 AA differences from the published sequence, but the cytoplasmic domain sequence matched.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pECE beta1 R760A was a gift from Kenneth Yamada (Addgene plasmid # 50511 ; http://n2t.net/addgene:50511 ; RRID:Addgene_50511)

  • For your References section:

    Specific beta1 integrin site selectively regulates Akt/protein kinase B signaling via local activation of protein phosphatase 2A. Pankov R, Cukierman E, Clark K, Matsumoto K, Hahn C, Poulin B, Yamada KM. J Biol Chem. 2003 May 16;278(20):18671-81. Epub 2003 Mar 11. 10.1074/jbc.M300879200 PubMed 12637511
Related items:
Commonly requested with: