Skip to main content
Addgene

pCDNA HA FAK Y576/577F
(Plasmid #50505)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50505 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCDNA HA
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    protein tyrosine kinase, mutated
  • Alt name
    FAK
  • Alt name
    PTK2
  • Species
    M. musculus (mouse)
  • Mutation
    Y576/577F
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer pCDNA FW (TTAATACGACTCACTATAGGG)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

HA tag variant: TMYDVPDYA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDNA HA FAK Y576/577F was a gift from Kenneth Yamada (Addgene plasmid # 50505 ; http://n2t.net/addgene:50505 ; RRID:Addgene_50505)
  • For your References section:

    PTEN interactions with focal adhesion kinase and suppression of the extracellular matrix-dependent phosphatidylinositol 3-kinase/Akt cell survival pathway. Tamura M, Gu J, Danen EH, Takino T, Miyamoto S, Yamada KM. J Biol Chem. 1999 Jul 16;274(29):20693-703. 10.1074/jbc.274.29.20693 PubMed 10400703