pCDNA alpha5
(Plasmid
#50500)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50500 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCDNA
-
Backbone manufacturerInvitrogen
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameintegrin, alpha 5
-
Alt nameITGA5
-
Alt namefibronectin receptor
-
SpeciesH. sapiens (human)
-
Entrez GeneITGA5 (a.k.a. CD49e, FNRA, VLA-5, VLA5A)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer pCDNA FW (TTAATACGACTCACTATAGGG) (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA alpha5 was a gift from Kenneth Yamada (Addgene plasmid # 50500 ; http://n2t.net/addgene:50500 ; RRID:Addgene_50500)