FN207
(Plasmid
#50497)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50497 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRSETC'
-
Backbone manufacturerInvitrogen
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNM_001306129.1
-
SpeciesH. sapiens (human)
-
Mutationrepeats 6-10
-
Entrez GeneFN1 (a.k.a. CIG, ED-B, FINC, FN, FNZ, GFND, GFND2, LETS, MSF, SMDCF)
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site NsiI (not destroyed)
- 5′ sequencing primer RSET FW (AATACGACTCACTATAGGGAG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FN207 was a gift from Kenneth Yamada (Addgene plasmid # 50497 ; http://n2t.net/addgene:50497 ; RRID:Addgene_50497) -
For your References section:
Requirement for the synergy site for cell adhesion to fibronectin depends on the activation state of integrin alpha 5 beta 1. Danen EH, Aota S, van Kraats AA, Yamada KM, Ruiter DJ, van Muijen GN. J Biol Chem. 1995 Sep 15;270(37):21612-8. 10.1074/jbc.270.37.21612 PubMed 7545166