FN 108
(Plasmid #50495)

• Depositing Lab: Kenneth Yamada
• Publication: Aota et al J Biol Chem. 1994 Oct 7;269(40):24756-61.

Backbone

• Vector backbone: pVC70108
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: fibronectin
• Alt name: FN1
• Alt name: FN type III repeats 9 and 10
• Species: H. sapiens (human)
• Mutation: repeats 9 and 10; EcoR1 site on III-9 is mutated, nt change T4153C
• Entrez Gene: FN1 (a.k.a. CIG, ED-B, FINC, FN, FNZ, GFND, GFND2, LETS, MSF, SMDCF)
• Promoter: T7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: T7

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Primers used for amplification of insert: primer A (CCATATGGGTCGACCCAACTGG), which contains an NdeI site, methionine start codon, and 5' end of the 9th type III repeat sequence, and primer B (ATGAATTCTACATCTGGGATGGTTTGTCAA), which contains an EcoRI site, a stop codon, and the 3' end of the 37-kDa fibronectin fragment.