Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSLIK-NFLAG-hFUS
(Plasmid #50487)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50487 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSLIK-neo
  • Backbone manufacturer
    Iain Fraser(Addgene plasmid #25735)
  • Backbone size w/o insert (bp) 13286
  • Total vector size (bp) 14200
  • Vector type
    Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FUS
  • Alt name
    fused in sarcoma
  • Alt name
    TLS
  • Alt name
    hnRNP P2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1680
  • GenBank ID
    NM_004960.3
  • Entrez Gene
    FUS (a.k.a. ALS6, ETM4, FUS1, HNRNPP2, POMP75, TLS, altFUS)
  • Promoter TRE
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TGGAGACGCCATCCACGCTG
  • 3′ sequencing primer CCATCTTTATGGCTCGAGATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLIK-NFLAG-hFUS was a gift from Zissimos Mourelatos (Addgene plasmid # 50487 ; http://n2t.net/addgene:50487 ; RRID:Addgene_50487)
  • For your References section:

    FUS regulates genes coding for RNA-binding proteins in neurons by binding to their highly conserved introns. Nakaya T, Alexiou P, Maragkakis M, Chang A, Mourelatos Z. RNA. 2013 Apr;19(4):498-509. doi: 10.1261/rna.037804.112. Epub 2013 Feb 6. 10.1261/rna.037804.112 PubMed 23389473