pcDNA3.1-nAChr-Alpha6-GFP
(Plasmid #50486)

• Purpose: this report is the first to directly measure nAChr subunit stoichiometry using FRET and plasma membrane localization of Alpha6 and Beta3 containing receptors using TIRF
• Depositing Lab: Henry Lester
• Publication: Drenan et al Mol Pharmacol. 2008 Jan;73(1):27-41. Epub 2007 Oct 11.

Backbone

• Vector backbone: pcDNA3.1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5428
• Total vector size (bp): 8997
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: nAChr-alpha6
• Alt name: Alpha6-GFP
• Species: M. musculus (mouse)
• Insert Size (bp): 3569
• Mutation: Gly-Ala-Gly flexible linker flanking the GFP open reading frame on both N and C terminal sides
• GenBank ID: BC031985
• Entrez Gene: Chrna6 (a.k.a. Acra6, Nica6)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP fusion in M3-M4 loop (after residue A405)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: XFP5’_F ATGGTGAGCAAGGGCGAGGAG –sits on 5’end of the fluorophore and is common to GFP ,CFP, YFP and mCherry
• 3′ sequencing primer: XFP3’_R CTTGTACAGCTCGTCCATGCC –sits on 3’end of the fluorophore and is common to GFP, CFP, YFP and mCherry

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry