Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1-nAChr-Alpha6-YFP
(Plasmid #50483)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50483 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5428
  • Total vector size (bp) 8997
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nAChr-alpha6
  • Alt name
    Alpha6-YFP
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3569
  • Mutation
    Gly-Ala-Gly flexible linker flanking the YFP open reading frame on both N and C terminal sides
  • GenBank ID
    BC031985
  • Entrez Gene
    Chrna6 (a.k.a. Acra6, Nica6)
  • Promoter CMV
  • Tag / Fusion Protein
    • YFP fusion in M3-M4 loop (after residue A405)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer XFP5’_F ATGGTGAGCAAGGGCGAGGAG –sits on 5’end of the fluorophore and is common to GFP ,CFP, YFP and mCherry
  • 3′ sequencing primer XFP3’_R CTTGTACAGCTCGTCCATGCC –sits on 3’end of the fluorophore and is common to GFP, CFP, YFP and mCherry
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-nAChr-Alpha6-YFP was a gift from Henry Lester (Addgene plasmid # 50483 ; http://n2t.net/addgene:50483 ; RRID:Addgene_50483)
  • For your References section:

    Subcellular trafficking, pentameric assembly, and subunit stoichiometry of neuronal nicotinic acetylcholine receptors containing fluorescently labeled alpha6 and beta3 subunits. Drenan RM, Nashmi R, Imoukhuede P, Just H, McKinney S, Lester HA. Mol Pharmacol. 2008 Jan;73(1):27-41. Epub 2007 Oct 11. 10.1124/mol.107.039180 PubMed 17932221