pAAV-GFAP-EGFP
(Plasmid #50473)

• Purpose: EGFP under the control of GFAP promoter
• Depositing Lab: Bryan Roth
• Publication: Roth lab DREADDs (unpublished)

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4818
• Total vector size (bp): 5490
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: EGFP
• Species: Aequorea victoria
• Insert Size (bp): 726
• Promoter: GFAP
• Tag / Fusion Protein:
  • N/A

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sal I (not destroyed)
• 3′ cloning site: EcoR I (not destroyed)
• 5′ sequencing primer: CCGGGCATCGCCAGTCTAGC
• 3′ sequencing primer: GCATTAAAGCAGCGTATCCACATAGC

Resource Information

• Articles Citing this Plasmid:
  • 13 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.