pAAV-GFAP-HA-rM3D(Gs)-IRES-mCitrine
(Plasmid #50472)

• Purpose: Gs-coupled rM3D-IRES-mCitrine under the control of GFAP promoter
• Depositing Lab: Bryan Roth
• Publication: Roth lab DREADDs (unpublished)

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4818
• Total vector size (bp): 7354
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: rM3D-IRES-mCitrine
• Species: H. sapiens (human)
• Insert Size (bp): 2588
• Mutation: See supplemental documents for DREADD mutations
• Entrez Gene: CHRM3 (a.k.a. EGBRS, HM3, PBS, m3AChR)
• Promoter: GFAP
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sal I (not destroyed)
• 3′ cloning site: EcoR I (not destroyed)
• 5′ sequencing primer: CCGGGCATCGCCAGTCTAGC
• 3′ sequencing primer: GCATTAAAGCAGCGTATCCACATAGC

Resource Information

• Supplemental Documents:
  • DREADD mutations
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.

Information for AAV5 (Catalog # 50472-AAV5)

Purpose

Ready-to-use AAV5 particles produced from pAAV-GFAP-HA-rM3D(Gs)-IRES-mCitrine (#50472). In addition to the viral particles, you will also receive purified pAAV-GFAP-HA-rM3D(Gs)-IRES-mCitrine plasmid DNA.

GFAP-driven HA-tagged rM3D(Gs) and bicistronic mCitrine expression, for chemogenetic excitation. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 1×10¹³ vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
• Buffer: PBS + 0.001% Poloxamer 188 + 200 mM NaCl
• Serotype: AAV5
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: mCitrine

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.