Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAG-GFPmG1
(Plasmid #50444)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50444 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAG-GFP
  • Backbone size w/o insert (bp) 4824
  • Total vector size (bp) 5552
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFPmG1
  • Alt name
    GFP E143K, N147Q
  • Species
    Aequorea victoria
  • Insert Size (bp)
    728
  • Mutation
    E143K, N147Q
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGACTTCCTTTGTCCCAAATCTG
  • 3′ sequencing primer TAGCCAGAAGTCAGATGCTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pCAG-GFP, Cepko lab

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-GFPmG1 was a gift from Connie Cepko (Addgene plasmid # 50444 ; http://n2t.net/addgene:50444 ; RRID:Addgene_50444)
  • For your References section:

    A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Tang JC, Szikra T, Kozorovitskiy Y, Teixiera M, Sabatini BL, Roska B, Cepko CL. Cell. 2013 Aug 15;154(4):928-39. doi: 10.1016/j.cell.2013.07.021. 10.1016/j.cell.2013.07.021 PubMed 23953120