pCVL iRFP-T2A-Trex2
(Plasmid #50418)

• Purpose: Coexpresses Trex2 and iRFP in mammalian cells.
• Depositing Lab: Andrew Scharenberg
• Publication: Trex2 plasmids (unpublished)

Backbone

• Vector backbone: pCVL.Active/Repressed TLR (Sce)
• Modifications to backbone: Replaced the sequence between the BamHI and NsiI sites of the vector.
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: iRFP
• Insert Size (bp): 948
• Promoter: SFFV
• Tag / Fusion Protein:
  • T2A (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: GAGCTCTATAAAAGAGCTCAC
• 3′ sequencing primer: TGCCCCACCATTTTGTTC

Gene/Insert 2

• Gene/Insert name: Trex2
• Promoter: SFFV
• Tag / Fusion Protein:
  • T2A (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: NsiI (not destroyed)
• 5′ sequencing primer: GAGCTCTATAAAAGAGCTCAC
• 3′ sequencing primer: TGCCCCACCATTTTGTTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

There are some discrepancies between Addgene's quality control sequence and the depositor sequence. These differences should not affect function.