-
PurposeExpress mCherry and FLAG-tagged human CD59, a GPI-AP in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50378 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepME-FLAG-CD59-GPI
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 6200
-
Modifications to backbonemCherry was amplified by PCR from pBS35 (Yeast Resource Center) by using upper and lower primers both containing NsiI sites and integrated into the pME-FLAG-CD59-GPI at SbfI site
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
Alt namemCherry-FLAG-CD59
-
SpeciesSynthetic
-
Insert Size (bp)700
- Promoter SR alpha
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SbfI (destroyed during cloning)
- 3′ cloning site SbfI (destroyed during cloning)
- 5′ sequencing primer gtgagcaagggcgaggaggat
- 3′ sequencing primer cttgtacagctcgtccatgcc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byRoger Tsien, PhD, Professor of Pharmacology at UC San Diego
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pME-mCherry-FLAG-CD59-GPI was a gift from Reika Watanabe (Addgene plasmid # 50378 ; http://n2t.net/addgene:50378 ; RRID:Addgene_50378) -
For your References section:
Exit of GPI-anchored proteins from the ER differs in yeast and mammalian cells. Rivier AS, Castillon GA, Michon L, Fukasawa M, Romanova-Michaelides M, Jaensch N, Hanada K, Watanabe R. Traffic. 2010 Aug;11(8):1017-33. doi: 10.1111/j.1600-0854.2010.01081.x. Epub 2010 May 11. 10.1111/j.1600-0854.2010.01081.x PubMed 20477992