pME-mCherry-FLAG-CD59-GPI
(Plasmid #50378)

• Purpose: Express mCherry and FLAG-tagged human CD59, a GPI-AP in mammalian cells
• Depositing Lab: Reika Watanabe
• Publication: Rivier et al Traffic. 2010 Aug;11(8):1017-33. doi: 10.1111/j.1600-0854.2010.01081.x. Epub 2010 May 11.

Backbone

• Vector backbone: pME-FLAG-CD59-GPI
• Backbone size w/o insert (bp): 5500
• Total vector size (bp): 6200
• Modifications to backbone: mCherry was amplified by PCR from pBS35 (Yeast Resource Center) by using upper and lower primers both containing NsiI sites and integrated into the pME-FLAG-CD59-GPI at SbfI site
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry
• Alt name: mCherry-FLAG-CD59
• Species: Synthetic
• Insert Size (bp): 700
• Promoter: SR alpha

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SbfI (destroyed during cloning)
• 3′ cloning site: SbfI (destroyed during cloning)
• 5′ sequencing primer: gtgagcaagggcgaggaggat
• 3′ sequencing primer: cttgtacagctcgtccatgcc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Roger Tsien, PhD, Professor of Pharmacology at UC San Diego
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry