pMSCV-mCherry-Vav1
(Plasmid #50044)

• Purpose: Expression of mCherry-Vav1 in mammalian cells
• Depositing Lab: Hidde Ploegh
• Publication: Strijbis et al PLoS Pathog. 2013 Jun;9(6):e1003446. doi: 10.1371/journal.ppat.1003446. Epub 2013 Jun 27.

Backbone

• Vector backbone: pMSCV
• Backbone size w/o insert (bp): 7000
• Total vector size (bp): 10000
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Vav1
• Species: M. musculus (mouse)
• Insert Size (bp): 3000
• Entrez Gene: Vav1 (a.k.a. Vav, vav-T)
• Promoter: pCMV
• Tag / Fusion Protein:
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AvrII (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CGCTTCAAGGTGCACATGGAG
• 3′ sequencing primer: CACGATGGTGTAGTCCTCGTTGTG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry