pRS303-pGAL-HA-SrtAstrep (pKS78)
(Plasmid
#50029)
-
PurposeGalactose-inducible expression of cytosolic S. pyogenes SrtA in yeast
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50029 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRS303
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 5000
-
Modifications to backboneInsertion of pGAL promoter (SacI/XbaI)
-
Vector typeYeast Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHA-SrtA(strep)
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)591
- Promoter pGAL
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGGTTTGTATTACTTCTTATTCAAATGTAATAAAAGTATC
- 3′ sequencing primer CCTAGACTTCAGGTTGTCTAACTCCTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS303-pGAL-HA-SrtAstrep (pKS78) was a gift from Hidde Ploegh (Addgene plasmid # 50029 ; http://n2t.net/addgene:50029 ; RRID:Addgene_50029) -
For your References section:
Protein ligation in living cells using sortase. Strijbis K, Spooner E, Ploegh HL. Traffic. 2012 Jun;13(6):780-9. doi: 10.1111/j.1600-0854.2012.01345.x. Epub 2012 Mar 23. 10.1111/j.1600-0854.2012.01345.x PubMed 22348280