Skip to main content
Addgene

pCS2+ Gal4-GBP2-IRES-GBP7-p65
(Plasmid #50020)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50020 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCS2+
  • Backbone size w/o insert (bp) 4086
  • Total vector size (bp) 6534
  • Vector type
    Multi-purpose expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Gal4DBD-GBP2-IRES-NLS-GBP7-p65AD
  • Alt name
    IRES-linked T-DDOG
  • Species
    Synthetic
  • Insert Size (bp)
    2448
  • Promoter CMV-immediate early promoter and SP6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GTAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CTGCATTCTAGTTGTGGTTTGTCC
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GBP2, GBP7 were obtained from Heinrich Leonhardt and Ulrich Rothbauer at Ludwig Maximilian University of Munich

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138.

Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2+ Gal4-GBP2-IRES-GBP7-p65 was a gift from Connie Cepko (Addgene plasmid # 50020 ; http://n2t.net/addgene:50020 ; RRID:Addgene_50020)

  • For your References section:

    A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Tang JC, Szikra T, Kozorovitskiy Y, Teixiera M, Sabatini BL, Roska B, Cepko CL. Cell. 2013 Aug 15;154(4):928-39. doi: 10.1016/j.cell.2013.07.021. 10.1016/j.cell.2013.07.021 PubMed 23953120
Related items:
Commonly requested with: