pMV306DIhsp+LuxG13
(Plasmid #49999)

• Purpose: Integrase removed to increase stability of the plasmid in mycobacteria
• Depositing Lab: Brian Robertson
• Publication: Andreu et al J Antimicrob Chemother. 2013 Sep;68(9):2118-27. doi: 10.1093/jac/dkt155. Epub 2013 Apr 30.

Backbone

• Vector backbone: pMV306hsp
• Backbone size w/o insert (bp): 6186
• Total vector size (bp): 9507
• Modifications to backbone: Integrase gene removed by inverse PCR.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Bacterial luciferase operon + G13 promoter
• Alt name: LuxABCDE
• Species: Mycobacterium marinum + Photorhabdus luminescens
• Insert Size (bp): 6186
• Mutation: It contains a gram-positive enhanced translation signal in front of luxA, luxC and luxe. G13 promoter cloned in front of luxC
• Promoter: G13 from M. marinum G13 promoter driving luxC

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRV (not destroyed)
• 5′ sequencing primer: agaataacgttggcactcgc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Genes were cloned from vector pSB2025 obtained from Dr. Phil Hill at Nottingham University.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The sequence of the Lux operon is theoretical. As such, there are a few differences between Addgene sequence and full plasmid sequence. These differences do not affect plasmid function.

Qazi, S.N., et al., agr expression precedes escape of internalized Staphylococcus aureus from the host endosome. Infect Immun, 2001. 69(11): p. 7074-82.