pMV306G13+FFlucRT
(Plasmid #49997)

• Purpose: Integrating vector with an improved Red-shifted Thermostable Firefly Luciferase
• Depositing Lab: Brian Robertson
• Publication: Andreu et al J Antimicrob Chemother. 2013 Sep;68(9):2118-27. doi: 10.1093/jac/dkt155. Epub 2013 Apr 30.

Backbone

• Vector backbone: pMV306
• Backbone size w/o insert (bp): 3995
• Total vector size (bp): 6071
• Vector type: Bacterial Expression ; Mycobacteria integrating vector

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: G13 promoter + Firefly luciferase Red Thermostable
• Alt name: FFlucRT
• Alt name: luc
• Species: Mycobacterium marinum + Photinus pyralis
• Insert Size (bp): 2155
• Mutation: Codon optimized for Mycobacterium tuberculosis with mutations to red-shift: Ile423Leu, Asp436Gly, Leu530Arg, Ser284Thr, Thr214Ala, Ala215Leu, Ile232Ala, Phe295Leu, and Glu354Lys
• GenBank ID: KC688279
• Promoter: G13 from M. marinum

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: aaccgtattaccgcctttga

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note that there are some discrepancies between Addgene's quality control sequence and the depositor's assembled full sequence. The Robertson lab reports that these differences will not affect the function of the plasmid.