Addgene: pMV306G13+FFlucRT Skip to main content
Addgene

pMV306G13+FFlucRT
(Plasmid #49997)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49997 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMV306
  • Backbone size w/o insert (bp) 3995
  • Total vector size (bp) 6071
  • Vector type
    Bacterial Expression ; Mycobacteria integrating vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    G13 promoter + Firefly luciferase Red Thermostable
  • Alt name
    FFlucRT
  • Alt name
    luc
  • Species
    Mycobacterium marinum + Photinus pyralis
  • Insert Size (bp)
    2155
  • Mutation
    Codon optimized for Mycobacterium tuberculosis with mutations to red-shift: Ile423Leu, Asp436Gly, Leu530Arg, Ser284Thr, Thr214Ala, Ala215Leu, Ile232Ala, Phe295Leu, and Glu354Lys
  • GenBank ID
    KC688279
  • Promoter G13 from M. marinum

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer aaccgtattaccgcctttga
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note that there are some discrepancies between Addgene's quality control sequence and the depositor's assembled full sequence. The Robertson lab reports that these differences will not affect the function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMV306G13+FFlucRT was a gift from Brian Robertson (Addgene plasmid # 49997 ; http://n2t.net/addgene:49997 ; RRID:Addgene_49997)
  • For your References section:

    Rapid in vivo assessment of drug efficacy against Mycobacterium tuberculosis using an improved firefly luciferase. Andreu N, Zelmer A, Sampson SL, Ikeh M, Bancroft GJ, Schaible UE, Wiles S, Robertson BD. J Antimicrob Chemother. 2013 Sep;68(9):2118-27. doi: 10.1093/jac/dkt155. Epub 2013 Apr 30. 10.1093/jac/dkt155 PubMed 23633686