pN565
(Plasmid #49990)

• Purpose: expresses an attenuated T7 RNAP under an isopropyl β-d-1-thiogalactopyranoside (IPTG) inducible control
• Depositing Lab: Christopher Voigt
• Publication: Rhodius et al Mol Syst Biol. 2013 Oct 29;9:702. doi: 10.1038/msb.2013.58.

Backbone

• Vector backbone: pIncW
• Modifications to backbone: Plasmid pIncW (pSa, SpR) was generated from pEXT21 (pSa,SpR) by deletion of osa, nuc1, the Tn21 integrase gene, and ORF18 (Temme, et al. PNAS 2012, PMID 22509035).
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Growth instructions: Plasmid is maintained at only 2-3 copies/cells, so it is difficult to sequence from minipreps (better to use PCR).
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: T7 RNAP*
• Alt name: attenuated T7 RNAP
• Species: Bacteriophage T7
• Mutation: R632S
• Promoter: pTac-symmetric
• Tag / Fusion Protein:
  • umuD degradation tag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: aaggcgcactcccgttctgg
• 3′ sequencing primer: attaccgcctttgagtgagc

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

CDS of the T7 RNAP starts with the GTG at the beginning of the sequence.