Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCDNA-HA-Rab35N120I
(Plasmid #49882)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 49882 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCDNA3.1+
  • Backbone manufacturer
    invitrogen
  • Backbone size w/o insert (bp) 5428
  • Total vector size (bp) 6028
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rab35
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    600
  • Mutation
    Asparagine 120 to Isoleucine
  • GenBank ID
    AF498960
  • Entrez Gene
    RAB35 (a.k.a. H-ray, RAB1C, RAY)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3X-HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site kpn (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer T7 Fwd (TAATACGACTCACTATAGGG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    derived from pCDNA3.1+HA-Rab35 (purchased from Missouri S&T cDNA Resource Center)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDNA-HA-Rab35N120I was a gift from Marci Scidmore (Addgene plasmid # 49882)