Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

SLIRP.HMG6.wt.fl
(Plasmid #49821)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49821 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHMG6
  • Backbone manufacturer
    none
  • Backbone size w/o insert (bp) 6518
  • Total vector size (bp) 6786
  • Modifications to backbone
    Codon-optimized for E. coli expression; ORF cloned into pHMG6 vector using TAGGGTACCGCGGCCGCCTCGAG extension from the 'stop' codon which has KpnI, EagI and XhoI sites.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Growth instructions
    for expression of protein, grown in BL21(DE3)
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SLIRP SRA stem-loop interacting RNA binding protein
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    330
  • Mutation
    wildtype codon-optimized for E. coli expression
  • GenBank ID
    NM_031210
  • Entrez Gene
    SLIRP (a.k.a. C14orf156, DC50, PD04872)
  • Promoter T7
  • Tag / Fusion Protein
    • E. coli Maltose Binding Protein (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer MBP internal primer: GCGGTCGTCAGACTGTCGATG
  • 3′ sequencing primer T7 terminator
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pHMG6 was from Berkeley Center for Structural Genomics; insertion of hSLIRP construct was done by this investigator

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SLIRP.HMG6.wt.fl was a gift from Thomas Cech (Addgene plasmid # 49821 ; http://n2t.net/addgene:49821 ; RRID:Addgene_49821)
  • For your References section:

    Structure and function of steroid receptor RNA activator protein, the proposed partner of SRA noncoding RNA. McKay DB, Xi L, Barthel KK, Cech TR. J Mol Biol. 2014 Apr 17;426(8):1766-85. doi: 10.1016/j.jmb.2014.01.006. Epub 2014 Jan 30. 10.1016/j.jmb.2014.01.006 PubMed 24486609