SLIRP.HMG6.wt.fl
(Plasmid #49821)

• Purpose: expression vector for MBP-SLIRP fusion
• Depositing Lab: Thomas Cech
• Publication: McKay et al J Mol Biol. 2014 Apr 17;426(8):1766-85. doi: 10.1016/j.jmb.2014.01.006. Epub 2014 Jan 30.

Backbone

• Vector backbone: pHMG6
• Backbone manufacturer: none
• Backbone size w/o insert (bp): 6518
• Total vector size (bp): 6786
• Modifications to backbone: Codon-optimized for E. coli expression; ORF cloned into pHMG6 vector using TAGGGTACCGCGGCCGCCTCGAG extension from the 'stop' codon which has KpnI, EagI and XhoI sites.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL10 Gold
• Growth instructions: for expression of protein, grown in BL21(DE3)
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SLIRP SRA stem-loop interacting RNA binding protein
• Species: H. sapiens (human)
• Insert Size (bp): 330
• Mutation: wildtype codon-optimized for E. coli expression
• GenBank ID: NM_031210
• Entrez Gene: SLIRP (a.k.a. C14orf156, DC50, PD04872)
• Promoter: T7
• Tag / Fusion Protein:
  • E. coli Maltose Binding Protein (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: MBP internal primer: GCGGTCGTCAGACTGTCGATG
• 3′ sequencing primer: T7 terminator

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pHMG6 was from Berkeley Center for Structural Genomics; insertion of hSLIRP construct was done by this investigator

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry