hSRAP.HMG6.wt.Dlnk.a13-236
(Plasmid
#49814)
-
Purposeexpression vector for MBP-SRAP(13-236) fusion
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49814 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHMG6
-
Backbone manufacturernone
- Backbone size w/o insert (bp) 6518
- Total vector size (bp) 7104
-
Modifications to backboneDeletion of linker between MBP-TEV and SRAP; initially cloned with TAGGGTACCGCGGCCGCCTCGAG sequence extending from 'stop' codon, which introduced AvrII and KpnI sites, and retained EagI, NotI and XhoI from parent vector. At 5' end, had an NdeI site which was removed in subsequent steps of multi-step process to make vector (check vector sequence for details). Then deleted coding sequence to second putative start codon, M13.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Growth instructionsfor expression of protein, grown in BL21(DE3)
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesteroid receptor RNA activator protein
-
Alt nameSRAP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)672
-
Mutationwildtype codon-optimized for E. coli expression
-
Entrez GeneSRA1 (a.k.a. SRA, SRAP, STRAA1, pp7684)
- Promoter T7
-
Tag
/ Fusion Protein
- E. coli Maltose Binding Protein (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (destroyed during cloning)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer MBP internal primer: GCGGTCGTCAGACTGTCGATG
- 3′ sequencing primer T7 terminator (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypHMG6 was from Berkeley Center for Structural Genomics; insertion of hSRAP construct was done by this investigator
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hSRAP.HMG6.wt.Dlnk.a13-236 was a gift from Thomas Cech (Addgene plasmid # 49814 ; http://n2t.net/addgene:49814 ; RRID:Addgene_49814) -
For your References section:
Structure and function of steroid receptor RNA activator protein, the proposed partner of SRA noncoding RNA. McKay DB, Xi L, Barthel KK, Cech TR. J Mol Biol. 2014 Apr 17;426(8):1766-85. doi: 10.1016/j.jmb.2014.01.006. Epub 2014 Jan 30. 10.1016/j.jmb.2014.01.006 PubMed 24486609