pFF19H
(Plasmid
#49783)
-
Purposeexpresses hygromycin resistance gene in plant cells
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49783 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFF19, Addgene plasmid #49777
-
Backbone manufacturerMessing Lab
-
Vector typeplant expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHPH
-
Alt namehygromycin resistance
-
Alt namehygromycin B phosphotransferase
-
SpeciesE. coli
- Promoter CaMV 35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site SphI (destroyed during cloning)
- 5′ sequencing primer 35S promoter (CTATCCTTCGCAAGACCCTTC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
polylinker: SalI, XbaI, BamHI, SmaI, KpnI, SstI/SacI, NruI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFF19H was a gift from Joachim Messing (Addgene plasmid # 49783 ; http://n2t.net/addgene:49783 ; RRID:Addgene_49783) -
For your References section:
The pFF plasmids: cassettes utilising CaMV sequences for expression of foreign genes in plants. Timmermans MC, Maliga P, Vieira J, Messing J. J Biotechnol. 1990 Jun;14(3-4):333-44. 10.1016/0168-1656(90)90117-T PubMed 1369289
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/46/16/8b062d2c-4c8e-11e3-839e-000c29055998.png.940x940_q85_autocrop.png)