Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFF19H
(Plasmid #49783)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49783 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFF19, Addgene plasmid #49777
  • Backbone manufacturer
    Messing Lab
  • Vector type
    plant expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HPH
  • Alt name
    hygromycin resistance
  • Alt name
    hygromycin B phosphotransferase
  • Species
    E. coli
  • Promoter CaMV 35S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site SphI (destroyed during cloning)
  • 5′ sequencing primer 35S promoter (CTATCCTTCGCAAGACCCTTC)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

polylinker: SalI, XbaI, BamHI, SmaI, KpnI, SstI/SacI, NruI

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFF19H was a gift from Joachim Messing (Addgene plasmid # 49783 ; http://n2t.net/addgene:49783 ; RRID:Addgene_49783)
  • For your References section:

    The pFF plasmids: cassettes utilising CaMV sequences for expression of foreign genes in plants. Timmermans MC, Maliga P, Vieira J, Messing J. J Biotechnol. 1990 Jun;14(3-4):333-44. 10.1016/0168-1656(90)90117-T PubMed 1369289