pFF19
(Plasmid #49777)

• Purpose: (Empty Backbone) plant expression cassette
• Depositing Lab: Joachim Messing
• Publication: Timmermans et al J Biotechnol. 1990 Jun;14(3-4):333-44.

Backbone

• Vector backbone: pUC120
• Backbone size (bp): 4200
• Modifications to backbone: 658 bp HincII-BglII fragnent from the CaMV strain CM1841 (the regulatory region from cauliflower mosaic virus) was cloned into the HincII-BamHI sites from pUC120. This was mutated to create unique XhoI site (7474). The flanking SstI, KpnI and SmaI sites were deleted by digestion with SstI and SmaI, Klenow treatment, and religation to make pFF12. Similarly, the HincII, PstI, and SphI sites were deleted to make pFF14. The 35S enhancer was duplicated by inserting the EcoRV-HindIII fragment from pFF14 into HincII-HindIII sites of pFF12. Then a polylinker was inserted as a mung bean nuclease treated HindIII fragment into the XhoI site which was filled in with Klenow fragment.
• Vector type: Plant expression
• Promoter: cauliflower mosaic virus (CaMV)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: 35 S promoter (CTATCCTTCGCAAGACCCTTC)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

polylinker sites: SphI, PstI, SalI, XbaI, BamHI, SmaI, KpnI, SstI/SacI, NruI