pVRc31_34
(Plasmid
#49747)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49747 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepVRc
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAS31_34
-
SpeciesBacillus subtilis subsp. subtilis str. 168
-
MutationCodon optimized for E.coli
- Promoter pLux
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GCGCTATCATGCCATACC
- 3′ sequencing primer GTTTCACTTCTGAGTTCGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVRc31_34 was a gift from Christopher Voigt (Addgene plasmid # 49747 ; http://n2t.net/addgene:49747 ; RRID:Addgene_49747) -
For your References section:
Design of orthogonal genetic switches based on a crosstalk map of sigmas, anti-sigmas, and promoters. Rhodius VA, Segall-Shapiro TH, Sharon BD, Ghodasara A, Orlova E, Tabakh H, Burkhardt DH, Clancy K, Peterson TC, Gross CA, Voigt CA. Mol Syst Biol. 2013 Oct 29;9:702. doi: 10.1038/msb.2013.58. 10.1038/msb.2013.58 PubMed 24169405