EGFP-OSBP-PH
(Plasmid #49571)

• Purpose: expresses the plekstrin homology domain of OSBP in mammalian cells
• Depositing Lab: Marci Scidmore
• Publication: Moorhead et al Infect Immun. 2010 May;78(5):1990-2007. doi: 10.1128/IAI.01340-09. Epub 2010 Mar 15.

Backbone

• Vector backbone: EGFP C2
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 5000
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: OSBP-PH (AA 91-179)
• Species: H. sapiens (human)
• Insert Size (bp): 300
• GenBank ID: NM_002556.2
• Entrez Gene: OSBP (a.k.a. OSBP1)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XhoI/SalI (destroyed during cloning)
• 5′ sequencing primer: EGFP C (CATGGTCCTGCTGGAGTTCGTG)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: OSBP derived from cMV6-XL6-OSBP purchased from Origene
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry