3xFNLDD/pMXs-puro
(Plasmid
#49536)
-
PurposeExpresses 3xFNLDD in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49536 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMXs-puro
-
Backbone manufacturerHodaka Fujii
- Backbone size w/o insert (bp) 5792
- Total vector size (bp) 6539
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3xFNLDD
-
Alt name3xFLAG-NLS-LexA binding domain
-
SpeciesSynthetic
-
Insert Size (bp)747
- Promoter LTR
-
Tags
/ Fusion Proteins
- 3xFLAG tag (N terminal on insert)
- NLS (nuclear localization signal) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR I (destroyed during cloning)
- 3′ cloning site Not I (destroyed during cloning)
- 5′ sequencing primer ggtggaccatcctctagact
- 3′ sequencing primer tggggactttccacaccctaactgacacacat (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information on Fujii Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/fujii/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
3xFNLDD/pMXs-puro was a gift from Hodaka Fujii (Addgene plasmid # 49536 ; http://n2t.net/addgene:49536 ; RRID:Addgene_49536) -
For your References section:
Identification of telomere-associated molecules by engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP). Fujita T, Asano Y, Ohtsuka J, Takada Y, Saito K, Ohki R, Fujii H. Sci Rep. 2013 Nov 8;3:3171. doi: 10.1038/srep03171. 10.1038/srep03171 PubMed 24201379