- 
            PurposeThis vector has been discontinued as of 5/8/2014. See Comments below for information on the updated version of the lentiCRISPR vector.
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49535 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepLKO_TRC005
- 
              Vector typeLentiviral, CRISPR
- 
                Selectable markersPuromycin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)Stbl3
- 
              Growth instructionsUse SapI digest to check for unwanted recombination of lentiviral plasmid. Only amplify in RecA- bacteria (eg. Stbl3).
- 
            Copy numberHigh Copy
Gene/Insert 1
- 
                Gene/Insert nameCas9
- 
                  Alt nameS. pyogenes CRISPR-Cas9
- 
                    SpeciesSynthetic
- 
                  Insert Size (bp)4200
- Promoter EFS
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GGTACAGTGCAGGGGAAAGA
- 3′ sequencing primer TGCCCTCCAAATATGTGAACT (Common Sequencing Primers)
Gene/Insert 2
- 
                Gene/Insert namePuromycin resistance
- 
                  Alt namepuromycin N-acetyl-transferase
- 
                  Alt namePAC
- 
                  Insert Size (bp)600
- Promoter EFS
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer TGCTGCTACTAAGAAAGCTGGTC (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
- 
            
            
            Addgene Notes
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
AS OF 5/8/2014, THIS VECTOR IS DISCONTINUED. Version 2 of the lentiCRISPR vector can be found here: http://www.addgene.org/52961
There is also now a two-plasmid lentiviral CRISPR system from the Zhang lab with the Cas9 and gRNA on separate plasmids:
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: lentiCRISPR was a gift from Feng Zhang (Addgene plasmid # 49535)
- 
                For your References section: Genome-scale CRISPR-Cas9 knockout screening in human cells. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelsen TS, Heckl D, Ebert BL, Root DE, Doench JG, Zhang F. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12. 10.1126/science.1247005 PubMed 24336571
 
    
 
                         
                         
             
             
             
             
          