Skip to main content
Addgene

Twitch-2B pcDNA3
(Plasmid #49531)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49531 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 7000
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Twitch-2B
  • Alt name
    TW2B
  • Species
    Opsanus tau
  • Insert Size (bp)
    1671
  • Promoter CMV
  • Tags / Fusion Proteins
    • ECFP (N terminal on insert)
    • cpCit174 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer ccgcggccGCCACCATGGTGAGCAAG
  • 3′ sequencing primer acattgaggattgagaattc
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

There is a discrepancy in the publication, Plasmid 48203: Twitch-2B pRSETB and Plasmid 49531: Twitch-2B pcDNA3 are misidentified.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Twitch-2B pcDNA3 was a gift from Oliver Griesbeck (Addgene plasmid # 49531 ; http://n2t.net/addgene:49531 ; RRID:Addgene_49531)

  • For your References section:

    Optimized ratiometric calcium sensors for functional in vivo imaging of neurons and T lymphocytes. Thestrup T, Litzlbauer J, Bartholomaus I, Mues M, Russo L, Dana H, Kovalchuk Y, Liang Y, Kalamakis G, Laukat Y, Becker S, Witte G, Geiger A, Allen T, Rome LC, Chen TW, Kim DS, Garaschuk O, Griesinger C, Griesbeck O. Nat Methods. 2014 Jan 5. doi: 10.1038/nmeth.2773. 10.1038/nmeth.2773 PubMed 24390440
Related items:
Commonly requested with: