EGFP-BICD1
(Plasmid
#49487)
-
Purposeexpresses EGFP-BICD1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49487 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneEGFP C2
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4371
- Total vector size (bp) 7641
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBICD1
-
Alt namebicaudal D1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2937
-
Mutation** see notes
-
GenBank IDNM_001003398.1
-
Entrez GeneBICD1 (a.k.a. BICD, bic-D 1)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI/BglII (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer EGFP C (CATGGTCCTGCTGGAGTTCGTG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PCR from HeLa cDNA with 5' BamHI Linkers plus 2 additional AA prior to ATG) and 3' SalI linkers cloned into BglII/SalI sites of EGFP C2
**From the associated publication: "Upon DNA sequencing, it was determined that amino acids 821 to 920 were deleted from ... EGFP-BICD1."
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-BICD1 was a gift from Marci Scidmore (Addgene plasmid # 49487 ; http://n2t.net/addgene:49487 ; RRID:Addgene_49487) -
For your References section:
The Rab6 effector Bicaudal D1 associates with Chlamydia trachomatis inclusions in a biovar-specific manner. Moorhead AR, Rzomp KA, Scidmore MA. Infect Immun. 2007 Feb;75(2):781-91. Epub 2006 Nov 13. 10.1128/IAI.01447-06 PubMed 17101644
Map uploaded by the depositor.