Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

EGFP-BICD1
(Plasmid #49487)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49487 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    EGFP C2
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4371
  • Total vector size (bp) 7641
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BICD1
  • Alt name
    bicaudal D1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2937
  • Mutation
    ** see notes
  • GenBank ID
    NM_001003398.1
  • Entrez Gene
    BICD1 (a.k.a. BICD, bic-D 1)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI/BglII (destroyed during cloning)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer EGFP C (CATGGTCCTGCTGGAGTTCGTG)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

PCR from HeLa cDNA with 5' BamHI Linkers plus 2 additional AA prior to ATG) and 3' SalI linkers cloned into BglII/SalI sites of EGFP C2

**From the associated publication: "Upon DNA sequencing, it was determined that amino acids 821 to 920 were deleted from ... EGFP-BICD1."

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP-BICD1 was a gift from Marci Scidmore (Addgene plasmid # 49487 ; http://n2t.net/addgene:49487 ; RRID:Addgene_49487)
  • For your References section:

    The Rab6 effector Bicaudal D1 associates with Chlamydia trachomatis inclusions in a biovar-specific manner. Moorhead AR, Rzomp KA, Scidmore MA. Infect Immun. 2007 Feb;75(2):781-91. Epub 2006 Nov 13. 10.1128/IAI.01447-06 PubMed 17101644