Skip to main content
Addgene

EGFP-Rab6AI46E
(Plasmid #49485)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49485 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    EGFP C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5320
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rab6AI46E
  • Alt name
    Rab6A isoform b
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    627
  • Mutation
    Isoleucine 46 to Glutamic Acid
  • GenBank ID
  • Entrez Gene
    RAB6A (a.k.a. RAB6)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI/BglII (destroyed during cloning)
  • 3′ cloning site Xho/SalI (destroyed during cloning)
  • 5′ sequencing primer EGFP C (CATGGTCCTGCTGGAGTTCGTG)
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    purchased pCDNA3.1+Rab6A from Missouri S&T cDNA Resource Center (cDNA.org). Quick Change mutagenesis

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP-Rab6AI46E was a gift from Marci Scidmore (Addgene plasmid # 49485)

  • For your References section:

    The Rab6 effector Bicaudal D1 associates with Chlamydia trachomatis inclusions in a biovar-specific manner. Moorhead AR, Rzomp KA, Scidmore MA. Infect Immun. 2007 Feb;75(2):781-91. Epub 2006 Nov 13. 10.1128/IAI.01447-06 PubMed 17101644
Related items: