pCAG-p65AD-GBP6
(Plasmid #49440)

• Purpose: Expression of a GFP-dependent transcription factor component in mammalian cells
• Depositing Lab: Connie Cepko
• Publication: Tang et al Cell. 2013 Aug 15;154(4):928-39. doi: 10.1016/j.cell.2013.07.021.

Backbone

• Vector backbone: pCAG-GFP
• Backbone size w/o insert (bp): 4823
• Total vector size (bp): 5834
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GBP6-p65 transactivation domain fusion protein
• Alt name: p65AD-GBP6
• Alt name: ADG
• Species: Synthetic
• Insert Size (bp): 1011
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (destroyed during cloning)
• 3′ cloning site: NotI (destroyed during cloning)
• 5′ sequencing primer: GGACTTCCTTTGTCCCAAATCTG
• 3′ sequencing primer: TAGCCAGAAGTCAGATGCTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: GBP6 was obtained from Heinrich Leonhardt and Ulrich Rothbauer at Ludwig Maximilian University of Munich
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138.

Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.