pCAG-GBP1-10gly-Gal4DBD
(Plasmid #49438)

• Purpose: Expression of a GFP-dependent transcription factor component in mammalian cells
• Depositing Lab: Connie Cepko
• Publication: Tang et al Cell. 2013 Aug 15;154(4):928-39. doi: 10.1016/j.cell.2013.07.021.

Backbone

• Vector backbone: pCAG-GFP
• Backbone size w/o insert (bp): 4823
• Total vector size (bp): 5666
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GBP1-Gal4 DNA binding domain fusion protein
• Alt name: GBP1-10gly-Gal4DBD
• Alt name: DBDG
• Species: Synthetic
• Insert Size (bp): 843
• Mutation: C98S (to increase protein solubility), Q3D
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GGACTTCCTTTGTCCCAAATCTG
• 3′ sequencing primer: TAGCCAGAAGTCAGATGCTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: GBP1 protein sequence was obtained from PDB website, 3K1K entry.
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The GBP1 used differs from the PDB GBP1 by two amino acids. One is Q3D at a site away from the GFP binding pocket and not expected to affect GFP binding. The second was a C98S mutation to enhance protein solubility.

Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138.

Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.