-
Purposeexpresses EGFP-Rab4A in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49434 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneEGFP C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 5300
-
Modifications to backbonenone
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRab4A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)657
-
GenBank IDAF498934
-
Entrez GeneRAB4A (a.k.a. HRES-1, HRES-1/RAB4, HRES1, RAB4)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI/BglII (destroyed during cloning)
- 3′ cloning site XhoI/SalI (destroyed during cloning)
- 5′ sequencing primer EGFP C (CATGGTCCTGCTGGAGTTCGTG) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypurchased from Missouri S&T cDNA Resource Center (cDNA.org) pCDNA3.1+Rab4A
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-Rab4A was a gift from Marci Scidmore (Addgene plasmid # 49434) -
For your References section:
Rab GTPases are recruited to chlamydial inclusions in both a species-dependent and species-independent manner. Rzomp KA, Scholtes LD, Briggs BJ, Whittaker GR, Scidmore MA. Infect Immun. 2003 Oct;71(10):5855-70. 10.1128/IAI.71.10.5855-5870.2003 PubMed 14500507