pCFD4-U6:1_U6:3tandemgRNAs
(Plasmid #49411)

• Purpose: expression of two gRNAs from Drosophila U6:1 and U6:3
• Depositing Lab: Simon Bullock
• Publication: Port et al Proc Natl Acad Sci U S A. 2014 Jul 7. pii: 201405500.

Backbone

• Vector backbone: pValium22
• Backbone manufacturer: Norbert Perrimon, Jian-Quan Ni, Harvard
• Total vector size (bp): 7159
• Vector type: Insect Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: dU6-1:gRNA
• Species: D. melanogaster (fly)
• Insert Size (bp): 900
• Promoter: dU6-1

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CGTTTTTAATAAAATACATTGCATAGATCTGAATTCATTTTCAACGTCCTCGATAGTA
• 3′ sequencing primer: GGCGTTTCATTCTACTCTG

Gene/Insert 2

• Gene/Insert name: dU6-3:gRNA
• Species: D. melanogaster (fly)
• Insert Size (bp): 700
• Promoter: dU6-3

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: AGGTTAGCTCGCCAAGCAG
• 3′ sequencing primer: GAATGCATACGCATTAAGCG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Fillip Port, Simon Bullock lab, MRC-LMB
• Articles Citing this Plasmid:
  • 80 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please acknowledge Fillip Port and Simon Bullock when publishing work derived from use of this plasmid.

Visit crisprflydesign.org for more information.