MSCV-FlagmuEzh2deltaset-Hygro
(Plasmid #49403)

• Purpose: Expresses a Delta-set deletion mutant of Flag Tagged Ezh2. Hygromycin resistant.
• Depositing Lab: Tobias Neff
• Publication: MSCV-FlagmusEzh2deltaSET-Hygro (unpublished)

Backbone

• Vector backbone: MSCV-hygro
• Modifications to backbone: none
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 3prime end of Flag-mus-Ezh2deltaSET, eliminating Set domain
• Alt name: EZH2
• Alt name: istone-lysine N-methyltransferase
• Species: M. musculus (mouse)
• Mutation: Set domain deleted
• Promoter: MSCV promotor
• Tag / Fusion Protein:
  • Flag

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bglii (not destroyed)
• 3′ cloning site: Xho1 (not destroyed)
• 5′ sequencing primer: TCAATATAATGATGATGATGATGACG
• 3′ sequencing primer: CCAGAGGCCACTTGTGTAGC

Resource Information

• Supplemental Documents:
  • Cloning Strategy
• A portion of this plasmid was derived from a plasmid made by: Addgene, Plasmid 24926: MSCVhygro-F-Ezh2 From Kai Ge
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This was cloned using fusion polymerase but the sequence has not been confirmed.