pmirGLO-Bmpr2-1719
(Plasmid #49379)

• Purpose: Insert is a fragment of the Bmpr2 3'-UTR that contains miR-17 and miR-19 binding sites. To be used for 3'UTR assay.
• Depositing Lab: Martine Roussel
• Publication: Murphy et al Cancer Res. 2013 Oct 21.

Backbone

• Vector backbone: pmirGLO
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 7350
• Total vector size (bp): 7377
• Modifications to backbone: For cloning oligonucleotides into pmirGLO, bp 7314-7331 were excised (region between PmeI and XbaI).
• Vector type: Luciferase
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: N/A
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Bmpr2
• Species: H. sapiens (human), M. musculus (mouse)
• Insert Size (bp): 45
• GenBank ID: NM_001204
• Entrez Gene: BMPR2 (a.k.a. BMPR-II, BMPR3, BMR2, BRK-3, POVD1, PPH1, T-ALK)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PmeI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: GAAGCTGAGTTGGCTGCT
• 3′ sequencing primer: CACTGCATTCTAGTTGTGGT

Resource Information

• Supplemental Documents:
  • Features list

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry