pAc-y1sgRNA-Cas9
(Plasmid #49331)

• Purpose: Expresses sgRNA targeting yellow gene and Cas9-Puro in Drosophila S2 cells
• Depositing Lab: Ji-Long Liu
• Publication: Bassett et al Biol Open. 2013 Dec 10. pii: bio.20137120v1. doi: 10.1242/bio.20137120.

Backbone

• Vector backbone: pAc-STABLE1-Puro
• Backbone manufacturer: Dr. James Sutherland
• Backbone size w/o insert (bp): 6600
• Total vector size (bp): 10658
• Vector type: Insect Expression, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Cas9
• Alt name: CRISPR associated 9
• Alt name: hspCas9
• Species: Synthetic; Streptococcus pyogenes
• Insert Size (bp): 4278
• Mutation: Human codon optimised
• Promoter: Actin-5c
• Tags / Fusion Proteins:
  • 3xFLAG (N terminal on insert)
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: gagttcttgtgctgtgtgga
• 3′ sequencing primer: tcgagacaaacggcgaaacc

Gene/Insert 2

• Gene/Insert name: dU6-sgRNA
• Species: D. melanogaster (fly), Synthetic
• Insert Size (bp): 500
• Promoter: Drosophila U6

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: GTTCGACTTGCAGCCTGAAATACG
• 3′ sequencing primer: AAAAAAGCACCGACTCGGTGC

Gene/Insert 3

• Gene/Insert name: y1 sgRNA
• Species: D. melanogaster (fly)
• Insert Size (bp): 20
• Entrez Gene: y (a.k.a. Dmel_CG3757, CG3757, Dmel\CG3757, EG:125H10.2, T6, Y)
• Promoter: Drosophila U6

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: BspQI (destroyed during cloning)
• 3′ cloning site: BspQI (destroyed during cloning)
• 5′ sequencing primer: GTTCGACTTGCAGCCTGAAATACG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The human codon optimised spCas9 gene was amplified from pX330 (Addgene plasmid 42230) deposited by Feng Zhang. The pAc-STABLE1-Puro plasmid was obtained from Dr James Sutherland.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

gRNA target sequence GGTTTTGGACACTGGAACCG