pBiFC-flag-hCaspase 2 CARD-VN173
(Plasmid #49260)

• Purpose: Expresses split fluorescence protein to measure caspase-2 dimerization in mammalian cells.
• Depositing Lab: Douglas Green
• Publication: Bouchier-Hayes et al Mol Cell. 2009 Sep 24;35(6):830-40. doi: 10.1016/j.molcel.2009.07.023.

Backbone

• Vector backbone: pBIFC-VN173
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 4360
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: caspase-2 CARD
• Species: H. sapiens (human)
• Mutation: delete aa 123-435
• GenBank ID: U13021
• Entrez Gene: CASP2 (a.k.a. CASP-2, ICH1, MRT80, NEDD-2, NEDD2, PPP1R57)
• Promoter: CMV
• Tags / Fusion Proteins:
  • Flag (N terminal on backbone)
  • split Venus N (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: catggactacaaagacgatgac
• 3′ sequencing primer: gtccagctcgaccaggatgggc

Resource Information

• Supplemental Documents:
  • BiFC caspase-2

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry