pWPT-GGG/ACC-mEGFP-IRES-mCherry
(Plasmid
#49230)
-
PurposeLentiviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49230 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePlasmid 12255: pWPT-GFP
- Backbone size w/o insert (bp) 8754
- Total vector size (bp) 10738
-
Modifications to backbone1. PCRed WPRE and ligated into XhoI site upstream of EF1-short and EcoRI site on 3' end of WPRE (EF1-short segment deleted. EcoRI site on 3' end of WPRE eliminated by ligation with MfeI on PCR product. WPRE sequence unaltered. WPRE PCRed and re-entered into vector to create unique XhoI, EcoRI, NotI sites on the 5' end of WPRE and to eliminate BamHI site). 2. EF1-short PCRed and ligated to XhoI and EcoRI sites on 5' end of WPRE. Original XhoI site upstream of EF1-short eliminated via ligation to SalI site on PCR product. Sites now between EF1 and WPRE are XhoI, BamHI, EcoRI, NotI. 3. The translation control elements, mEGFP, IRES, and mCherry segment from the corresponding pCur5-XX-mEGFP-IRES-mCherry was ligated into the pWPT-EF1short-WPRE backbone via XhoI and NotI sites.
-
Vector typeMammalian Expression, Lentiviral, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemEGFP
-
SpeciesSynthetic
-
Insert Size (bp)732
- Promoter EF1-short
-
Tag
/ Fusion Protein
- SfuI site to create C-terminal fusions (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site SfuI (not destroyed)
- 5′ sequencing primer ccgagggtgggggagaac (5 to 3)
- 3′ sequencing primer AGGGCGAGGGCGATGCCACCTA (5' to 3') (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)711
- Promoter EF1-short
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GTCACCTTCAGCTTGGCGG (5' to 3')
- 3′ sequencing primer CATTAAAGCAGCGTATCC (5 to 3) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Vector allows for control of transgene expression at the level of translation. It is 1 vector in a set of 9 that spans a range of expression levels. Sequencing through any part of the IRES sequence is not advised. Expression of gene downstream of IRES remains constant, despite varying expression of gene upstream.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWPT-GGG/ACC-mEGFP-IRES-mCherry was a gift from Clifford Wang (Addgene plasmid # 49230 ; http://n2t.net/addgene:49230 ; RRID:Addgene_49230) -
For your References section:
Tuning gene expression with synthetic upstream open reading frames. Ferreira JP, Overton KW, Wang CL. Proc Natl Acad Sci U S A. 2013 Jul 9;110(28):11284-9. doi: 10.1073/pnas.1305590110. Epub 2013 Jun 24. 10.1073/pnas.1305590110 PubMed 23798422