pWPT-ACC/ACC-mEGFP-IRES-mCherry
(Plasmid #49229)

• Purpose: Lentiviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.
• Depositing Lab: Clifford Wang
• Publication: Ferreira et al Proc Natl Acad Sci U S A. 2013 Jul 9;110(28):11284-9. doi: 10.1073/pnas.1305590110. Epub 2013 Jun 24.

Backbone

• Vector backbone: Plasmid 12255: pWPT-GFP
• Backbone size w/o insert (bp): 8754
• Total vector size (bp): 10738
• Modifications to backbone: 1. PCRed WPRE and ligated into XhoI site upstream of EF1-short and EcoRI site on 3' end of WPRE (EF1-short segment deleted. EcoRI site on 3' end of WPRE eliminated by ligation with MfeI on PCR product. WPRE sequence unaltered. WPRE PCRed and re-entered into vector to create unique XhoI, EcoRI, NotI sites on the 5' end of WPRE and to eliminate BamHI site). 2. EF1-short PCRed and ligated to XhoI and EcoRI sites on 5' end of WPRE. Original XhoI site upstream of EF1-short eliminated via ligation to SalI site on PCR product. Sites now between EF1 and WPRE are XhoI, BamHI, EcoRI, NotI. 3. The translation control elements, mEGFP, IRES, and mCherry segment from the corresponding pCur5-XX-mEGFP-IRES-mCherry was ligated into the pWPT-EF1short-WPRE backbone via XhoI and NotI sites.
• Vector type: Mammalian Expression, Lentiviral, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: mEGFP
• Species: Synthetic
• Insert Size (bp): 732
• Promoter: EF1-short
• Tag / Fusion Protein:
  • SfuI site to create C-terminal fusions (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: SfuI (not destroyed)
• 5′ sequencing primer: ccgagggtgggggagaac (5 to 3)
• 3′ sequencing primer: AGGGCGAGGGCGATGCCACCTA (5' to 3')

Gene/Insert 2

• Gene/Insert name: mCherry
• Species: Synthetic
• Insert Size (bp): 711
• Promoter: EF1-short

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GTCACCTTCAGCTTGGCGG (5' to 3')
• 3′ sequencing primer: CATTAAAGCAGCGTATCC (5 to 3)

Resource Information

• Supplemental Documents:
  • pWPT-ACC/ACC-mEGFP-IRES-mCherry

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Vector allows for control of transgene expression at the level of translation. It is 1 vector in a set of 9 that spans a range of expression levels. Sequencing through any part of the IRES sequence is not advised. Expression of gene downstream of IRES remains constant, despite varying expression of gene upstream.