pCru5-/UAA-mEGFP-IRES-mCherry
(Plasmid
#49225)
-
PurposeRetroviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49225 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCru5
- Total vector size (bp) 6969
-
Vector typeMammalian Expression, Retroviral, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemEGFP
-
SpeciesSynthetic
-
Insert Size (bp)732
- Promoter Viral LTR (or CMV)
-
Tag
/ Fusion Protein
- SfuI site to create C-terminal fusions (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NsiI (not destroyed)
- 5′ sequencing primer GGATACACGCCGCCCACGTG (5' to 3')
- 3′ sequencing primer AGGGCGAGGGCGATGCCACCTA (5' to 3') (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)711
- Promoter Viral LTR (or CMV)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GTCACCTTCAGCTTGGCGG (5' to 3')
- 3′ sequencing primer ATGGCGTTACTTAAGCTAG (5' to 3') (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Vector allows for control of transgene expression at the level of translation. It is 1 vector in a set of 9 that spans a range of expression levels. Sequencing through any part of the IRES sequence is not advised. Expression of gene downstream of IRES remains constant, despite varying expression of gene upstream.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCru5-/UAA-mEGFP-IRES-mCherry was a gift from Clifford Wang (Addgene plasmid # 49225 ; http://n2t.net/addgene:49225 ; RRID:Addgene_49225) -
For your References section:
Tuning gene expression with synthetic upstream open reading frames. Ferreira JP, Overton KW, Wang CL. Proc Natl Acad Sci U S A. 2013 Jul 9;110(28):11284-9. doi: 10.1073/pnas.1305590110. Epub 2013 Jun 24. 10.1073/pnas.1305590110 PubMed 23798422